The next primer sets were found in this scholarly research; rat Hoxc8, forwards: CCTCCGCCAACACTAACAGT, change: GGGGAAGGCCAAAGGTAATA; rat Lhx2, forwards: CCAAGGACTTGAAGCAGCTC, change: AGGCGAGATCCTAAAACGTG; rat Foxg1, forwards: … Continue reading The next primer sets were found in this scholarly research; rat Hoxc8, forwards: CCTCCGCCAACACTAACAGT, change: GGGGAAGGCCAAAGGTAATA; rat Lhx2, forwards: CCAAGGACTTGAAGCAGCTC, change: AGGCGAGATCCTAAAACGTG; rat Foxg1, forwards: TCAATGACTTCGCAGACCAG, slow: ATTCTCCCACATTGCACCTC; rat Gapdh, forwards: ATTGTCAGCAATGCATCCTGCA, change: AGACAACCTGGTCCTCAGTGTA
Copy and paste this URL into your WordPress site to embed
Copy and paste this code into your site to embed